Overuse of natural resources by humans is a major threat to biodiversity. Overuse often involves species of economic or esthetic value, and fish are a typical example for a group that is exploited both for economic reasons (for human consumption) and for esthetic reasons (e.g. by aquarists). Pseudorhodeus tanago (Tanaka, 1909) (formerly known as Tanakia tanago) is a small colorful but legally protected (fishing, keeping and transfer are banned) bitterling fish distributed around Tokyo, Japan. Whereas it is critically endangered and more and more habitat loss has occurred, at least four stocks have been newly found during the last decade. To explore whether emergence of these newly found habitats is a consequence of incomplete survey, we genotyped mitochondrial cytochrome b sequence of P. tanago from 17 localities and an illegal home aquarium. Populations known by the past extensive survey (13 localities) showed geographically structured population genetic characteristics. Population-specific haplotypes were common indicating past divergence and bottleneck events. Four (north, {center + west}, south_1, south_2) or five (north, center, west, south_1, south_2) geographic groups were detectable as for these known localities. On the other hand, newly found stocks were polymorphic and showed identical haplotypes from distant known localities. If we assume historical basis of distribution and genetic characteristics of these newly found stocks, it must be a series of unlikely geological events and haplotype sorting. We discuss potential issues posed by these questionable stocks.

Bottleneck, bucket biology, conservation genetics, fish dumping, home aquarium, phylogeography, poaching, satoyama, Tanakia tanago

Overuse of organisms by hunting or fishing for trade or esthetic purposes is one of the biggest threats to biodiversity. Controlling these activities is fundamental for ensuring the persistence of endangered organisms, particularly those that have traits attractive to humans. Alerts to poaching are thus necessary on those organisms legally protected. Not only tusks of elephants and rhinos but beautifully colored bodies of fish as well have attracted violators. The red list of Japanese brackish and freshwater fish (Ministry of the Environment, Japan 2015) acknowledges 39 species out of 168 of endangered and vulnerable categories have threats of overfishing in connection with home aquarium. Inversely, unauthorized fish release also threatens the integrity of natural fish population structures. A big source of invasion of alien freshwater fish is fish dumping from home aquaria (Lintermans 2004, Gertzen et al. 2008, Fuller et al. 2013, Ishikawa and Tachihara 2014). Poaching and dumping of endangered and protected fish, if any, disturb conservation programs and policy making and ultimately threat that species.

Pseudorhodeus tanago (Tanaka, 1909) (formerly known as Tanakia tanago transferred to the new genus, Chang et al. 2014) is a colorful small bitterling fish endemic to Japan with a limited geographic range around Tokyo. Habitats of P. tanago are in small water bodies such as ditches or ponds with spring water in hills (Nakamura 1969, Mochizuki 1997, Maita 2002, Ishinabe 2014). These habitats link with traditional agricultural landscape known as ‘satoyama’. Traditional farming activities have maintained ditches, ponds and vegetation around waters in farmlands in hills (Kobori and Primack 2003), and thus maintained habitats of P. tanago. However, because of heavily populated and highly developed areas around its habitats, P. tanago is critically endangered. Urbanization accompanying change of farming style gives rise to habitat loss (Mochizuki 1997, Ishinabe 2014). Agency for Cultural Affairs, and Ministry of the Environment, Japan have endorsed this bitterling as a legally protected species (Ministry of the Environment, Japan 2015). Fishing, keeping and transfer of P. tanago are banned. Since around 1970, conservation measures of P. tanago have been taken under local bases including extensive search for habitats, development of ex situ breeding techniques, protected area enclosure, mitigation of civil engineering activities (Tochigi Prefectural Fisheries Experimental Station 1973, Akiyama et al. 1994, Mochizuki 1997, Kubota et al. 2010, Ishinabe 2014). A national breeding program for the protection of the species began in 1995, which included ex situ breeding and habitat restoration (Agency of Environment, Japan et al. 1995).

Records of 45 localities of P. tanago habitats were established as part of an extensive survey (Tanaka 1909, Nakamura 1969, Maita 2002, Ishinabe 2014, present report) (Fig. 1a). Some of the localities have been kept secret by authorities because of risks of poaching. By around 2000, most known habitats were lost, and further local extinction has occurred in these days in spite of conservation measures (Fig. 1b). Many populations have undergone habitat degradation to decline to ca. 1/100 in a few years, and in an extreme case the population is vanishing in the final remnant habitat of a short (< 100 m) stretch of a small (ca. 60 cm wide) stream (Mochizuki 1997).

From the habitat characteristics of P. tanago, confined and scattered among headwaters of fine branching dales in agricultural landscape on hill terrains, we assume geographically structured population genetic characteristics of this species. Kubota et al. (2010) outlined geographic population structure of this species, but lack of localities from southern part of its geographic range and usage of questionable specimens obscured clear-cut geographic structure. Analysis of geographic population structure of this critically endangered fish with habitat loss based on specimens from reliable sources is necessary for setting up conservation programs (Waples and Gaggiotti 2006).

Whereas more and more local populations have been lost recently, P. tanago were newly found in a few localities in the last decade (‘newly found’ locality or stock hereafter) (Fig. 1b, hatched areas). Are these newly found stocks are simply because of incomplete survey of distribution? The aims of this study were to delineate geographical genetic structure of P. tanago and to identify symptom of disturbance, if any, in this structure by an analysis of genotypes of 80 individuals from 18 populations or stocks. Four of them are from newly found localities, one from an illegal home aquarium, and the others are from localities previously known by the past extensive survey (‘known’ localities or populations hereafter).

Pseudorhodeus tanago from 13 known localities collected from 1993 through 2013 (55 individuals), four newly found stocks collected from 2010 through 2014 (22 individuals), and three individuals seized from an illegal home aquarium were materials of this research (Table 1, Fig. 1b). Fishes from two out of the 13 known localities were of ex situ preserved stock extinct in the wild in early 1990s (#8) and late 1970s (#10). Habitat characteristics of the collecting localities were identical to descriptions in literatures (Nakamura 1969, Mochizuki 1997, Maita 2002) except for two newly found localities (#14, 17) where civil engineering activities including straight cut of channels with concrete enforcement have suffered their habitats.

Figure 1.

Past (a) and present (b) geographic distribution of Pseudorhodeus tanago. Dots indicate records of presence of the bitterling. Light blue painted areas contain one to three localities from which specimens of the present report came. Exact places of these localities are kept secret by authorities to protect from poaching. Numbers on map b stand for localities of samples listed in Table 1. Asterisks indicate extinction in the wild and specimens came from ex situ preserved stocks. Habitats #14–17 in hatched areas (exact places are kept secret by authorities) are newly found. Hatched areas thus do not represent exact geographic ranges.

Extraction of DNA was done from fin clips with QuickGene DNA Tissue kit on QuickGene-810 (Kurabo, Neyagawa, Japan). PCR primers were L14695 on the L-strand (AATTYTTGCTCRGACTCTAACC) and H15910 on the H-strand (GATCTTCGGATTACAAGACCGAT) which worked for amplifying a 1219 bp mitochondrial DNA fragment encompassing the whole cytochrome b gene and flanking tRNA partial sequences. PCR reaction mixture of 12.5 μL contained 1μL of template DNA, 0.96 μL of dNTP mix (2.5 nmol each), 1.2 μL of 10x ExTaq buffer, 0.06 μL (0.3 U) of ExTaq (Takara, Shiga, Japan), 1 μL of primers (5 pmol each), 7.28 μL of Milli-Q grade water. PCR reaction was of touchdown profile (Don et al. 1991) in which annealing temperatures dropped from 59°C down to 53°C in the initial 7 cycles and was constant at 55°C in the remaining 28 cycles (35 cycles in total). The PCR reaction started with 3 min at 94°C followed by 35 cycles of 30 sec at 94°C, 30 sec at the above touchdown annealing temperatures, 120 sec at 72°C with final extension at 72°C for 5 min. The PCR primers and two internal primers (L15438 [TTTTCCTACAAAGATCTATTAGG] and H15569 [CGTAAGATGGCGTAGGCAAATAA] on the L- and H-strand, respectively) worked for overlapping double-stranded sequencing with BigDye terminator v.3.1 kit run on an ABI3730 sequencer (ABI, Foster City CA, USA). The complete mitochondrial cytochrome b sequences used in this research have DDBJ/GenBank entries of LC17598–LC170677.

Indices of nucleotide divergence were calculated with Arlequin v.3.5 (Excoffier and Lischer 2010). Geographic population structure was assessed with SAMOVA v.2.0 (Dupanloup et al. 2002). The net nucleotide divergence was calculated by π_xy-(π_x+π_y)/2 where π_xy is average number of nucleotide differences between populations x and y, and π_x and π_y stand for this value between individuals within populations x and y. Parsimonious haplotype network was drawn with TCS v.1.2.1 (Clement et al. 2000).

We dedicate this paper to Toshihiro Ishinabe (deceased) (Kannonzaki Nature Museum) and his contributions to conservation of Pseudorhodeus tanago over two decades carrying out habitat monitoring and ex situ breeding. KS, NS and KI conceived this research. KS analyzed data and drafted the manuscript. NS, MO, KI, TS, TM, TT and MT conducted field survey. All authors read, improved and approved the manuscript. This research was financially supported by a Protective Breeding Program of Ministry of the Environment, Japan. Permission for research use of P. tanago was provided by Agency for Cultural Affairs and Ministry of the Environment, Japan to NS and KI. We have no financial conflict of interests about contents of this publication. Specimens were collected under a condition in which the authorities expect non-disclosure of exact places of habitats except for a protected and publicly opened locality (#13). NS and KI are employees of two of these authorities that do not disclose some localities. Toshihiro Ishinabe, Hitoshi Kubota (Tochigi Prefectural Government), Kouki Kano (Ibaraki University), Masaki Miya (Natural History Museum and Institute, Chiba), Naoyuki Suguro (Kanagawa Prefectural Fisheries Technology Center) and Kazuhiro Umezawa (Saitama Prefectural Government) helped us collecting specimens. Maya Suzuki (Kanto Regional Environment Office, Ministry of the Environment) helped and coordinated field survey and sample collection. Takahiro Ohtsuka (National Research Institute of Fisheries Science) helped us for laboratory works.